Indian Gooseberry Water Kefir Sweetened with Inulin: A Low-Sugar Functional Beverage for Modulating Adipocyte Differentiation and Reducing Lipogenesis
Natsinee U-on, Yingmanee Tragoolpua, Aussara Panya, Arisa Imsumran, and Itthayakorn Promputtha*Abstract In response to the rising obesity epidemic, extensive research has explored various treatment approaches. Kefir, a fermented beverage traditionally made from milk, offers a range of health benefits, including improved gut health and anti-inflammatory effects, and has been shown to decrease lipid synthesis in adipocytes. However, the dairy content and high caloric value of milk kefir limit its suitability for some consumers. To address this, a novel low-calorie Indian gooseberry water kefir was developed in this study, leveraging the well-known antioxidative, antimicrobial, and anti-lipogenic properties of Indian gooseberry. This functional beverage was enriched with inulin to further enhance its health benefits while keeping the calorie content low. This research examines the effects of various Indian gooseberry kefir formulations, including low-calorie inulin-enriched kefir, on lipid accumulation and adipogenic transcription factor expression in 3T3-L1 adipocytes. A 100-fold dilution of Indian gooseberry kefir exhibited no cytotoxic effects on the cells. Treatment with the low-calorie kefir significantly reduced intracellular lipid accumulation in 3T3-L1 adipocytes to 88.86 ± 3.24% of the control via downregulation of C/EBPβ and PPAR-γ mRNA expression, which are key genes involved in the early stages of adipocyte differentiation. Additionally, kefir treatment decreased the expression of ACC and FAS genes, which are crucial for lipogenesis during the later stages of adipogenesis. These findings demonstrate the potential of low-calorie, inulin-enriched Indian gooseberry kefir as a functional beverage for obesity management. Its anti-lipogenic effects, lack of cytotoxicity, and reduced caloric content make it a viable alternative to traditional milk kefirs, broadening its accessibility for consumers.
Keywords: Adipogenic transcription factors, Functional beverage, Inulin, Obesity control, Water kefir
Funding: This research was funded by the National Research Council of Thailand (NRTC) [grant number N23A640051].
Citation: U-on, N., Tragoolpua, Y., Panya, A., Imsumran, A., and Promputtha, I. 2026. Indian gooseberry water kefir sweetened with inulin: A low-sugar functional beverage for modulating adipocyte differentiation and reducing lipogenesis. Natural and Life Sciences Communications. 25(3): e2026069.
Graphical Abstract:

INTRODUCTION
Obesity is a global public health concern that has garnered significant attention worldwide. The World Health Organization (WHO) defines obesity as the abnormal or excessive accumulation of fat that poses health risks (Chooi et al., 2019). Consequently, numerous approaches have been explored to manage obesity and prevent associated diseases. These include exercise, surgical interventions, medication, and the use of natural dietary supplements. Among these supplements, probiotics stand out as they are composed of live microorganisms that confer beneficial effects on the host by enhancing intestinal balance (Vijayaram et al., 2018). Probiotics can thrive in a variety of foods, particularly dairy products such as yogurt and milk kefir. Milk kefir is a traditional fermented dairy product which is rich in probiotics and resembles yogurt in appearance. However, kefir is composed of distinct beneficial bacteria, including lactic acid bacteria (LAB), acetic acid bacteria (AAB), and yeasts. Kefir is characterized by its yeasty, acidic, mildly alcoholic, refreshing, and slightly effervescent qualities. It is believed to contain various functional substances that contribute to its health benefits (Alsayadi et al., 2014). Nonetheless, the consumption of milk kefir is limited to individuals who are either vegetarian or have dairy allergies. As a solution, non-dairy kefir variations, including sugary kefir, rice milk kefir, fruit juice kefir, and herbal water kefir, have been developed and collectively termed as "water kefir" (Sabokbar et al., 2015).
Water kefir is a non-dairy kefir product created by fermenting a mixture of water, fruits, herbs, and sucrose sugar with microorganisms present in kefir grains. Various studies have suggested that water kefir offers health benefits comparable to milk kefir and other non-dairy beverages like kombucha. These benefits encompass anti-oxidation, anti-pathogenic properties, and even anti-lipogenesis effects (Monajjemi et al., 2012; Alsayadi et al., 2014; Sabokbar et al., 2015). Notably, water kefir typically displays a more diverse array of bacterial strains compared to those found in kombucha. Nevertheless, the escalating demand for water kefir is shadowed by a concern stemming from its relatively high calorie content. This concern persists despite the shift towards utilizing alternative low-calorie sweeteners in sugary beverages, such as stevia, monk fruit extract, and inulin (Moghadam et al., 2019). Inulin has gained popularity among individuals aiming to control and shed weight due to its health-promoting attributes, serving as a soluble fiber source beneficial for digestive health and acting as a prebiotic, fostering gut microbial balance
(Teferra et al., 2021).
Indian gooseberry (Phyllanthus emblica), commonly known as amla, is a nutrient-dense fruit recognized for its health-promoting properties, including antioxidant, anti-inflammatory, and antimicrobial activities (Sharma et al., 2020; Kabade, 2022). A recent study by Klawpiyapamornkun et al. (2023) demonstrated the efficacy of dried Indian gooseberry kombucha produced on a pre-industrial scale, highlighting its chemical composition, antioxidant properties, and antibacterial activity. This work underscores the potential of Indian gooseberry as a suitable substrate for fermentation to produce beverages with substantial health benefits (Gandhi et al., 2025). However, while fermented beverages like kombucha derived from Indian gooseberry have been well-studied, the application of this fruit in water kefir fermentation remains unexplored. Furthermore, there is a lack of studies investigating the anti-lipogenic potential of Indian gooseberry-based fermented beverages (Park et al., 2022). Our preliminary research demonstrated that Indian gooseberry water kefir effectively demonstrated anti-lipogenic effects in 3T3-L1 adipocytes. Briefly, among ten herbal water kefirs, Indian gooseberry water kefir reduced intracellular lipid accumulation and decreased GPDH enzyme activity more than the other herbal water kefirs, without inducing toxicity. While this study was insightful, it left an important gap in understanding as the precise role of kefir in inhibiting the lipogenesis mechanism within 3T3-L1 adipocytes remains unexplored. Hence, we investigated whether inulin-fortified Indian gooseberry water kefir suppresses adipogenesis and lipogenesis in 3T3-L1 adipocytes.
The objectives of this study are to develop low-calorie Indian gooseberry water kefir and examine its effects on intracellular lipid accumulation in 3T3-L1 adipocytes across a range of conditions. Additionally, the study aims to investigate the impact of the kefir on gene expression relevant to adipocyte differentiation and lipogenesis. Furthermore, it seeks to evaluate the potential anti-lipogenic properties of the Indian gooseberry water kefir by assessing the downregulation of specific transcription factor genes within the lipogenesis pathway. Lastly, the study aims to provide insights into the potential of Indian gooseberry water kefir as a health-promoting option for individuals concerned with obesity and its associated health implications.
MATERIALS AND METHODS
Indian gooseberry kefir preparation
Four distinct water kefir grains were purchased from local distribution stores in different provinces of Thailand: Chon Buri (G1), Pathum Thani (G2), Khon Kaen (G3), and Chiang Mai (G4). The acquired water kefir grains were stored at 4°C to ensure their viability before the fermentation process. Two varieties of Indian gooseberries, namely Local Indian gooseberry (I1) and Giant Indian gooseberry (I2), were dried at 60°C using a hot-air oven. Subsequently, they were blended, boiled, and filtrated then served as a basis for producing Indian gooseberry kefir. To prepare the base substrate for Indian gooseberry water kefir, 3 grams of this powder were mixed with 100 mL of distilled water. The mixture was then boiled at 100°C for 20 minutes to extract beneficial compounds. Finally, the solution was filtered to remove any remaining solids. Each type of Indian gooseberry water was categorized into four distinct groups, each differing in sugar composition: 20% (w/v) brown sugar (20B), 10% (w/v) brown sugar (10B), 10% (w/v) inulin (10I), and a combination of 10% (w/v) inulin and 10% brown sugar (10I10B). All these mixtures underwent sterilization through autoclaving at 110°C for 10 min. The sterilized mixtures of both I1 and I2 were then inoculated with 2% (w/v) of the respective water kefir grains (G1, G2, G3, and G4). The mixtures were incubated in an incubator at 25°C for 48 h, resulting in the creation of various kefir variations: G1I1, G1I2, G2I1, G2I2, G3I1, G3I2, G4I1, and G4I2. The entire experiment was conducted in triplicate, utilizing Erlenmeyer flasks containing 200 ml of the mixtures. After the fermentation process, the weight of the grains and the pH values of the resulting liquor were measured. For the subsequent 3T3-L1 adipocytes experiment, the kefir samples underwent filtration using a 0.25 µm filter to prepare them appropriately. Additionally, kefir samples were serially diluted to different dilutions: 200-fold, 100-fold, 50-fold with sterile distilled water prior to analysis.
Cell culture, adipocyte differentiation, and treatment procedures
The procedures were modified from Ho et al. (2013). The 3T3-L1 mouse pre-adipocyte cell lines (IFO50416) were purchased from the Japanese Collection of Research Bioresources Cell Bank (JCRB), National Institute of Biomedicine Innovation, Ibaraki, Osaka, Japan. These cells were cultivated in T25 flasks using Dulbecco's modified Eagle's medium (DMEM, Hyclone, Utah, USA), supplemented with 10% calf serum (CS, Hyclone, Utah, USA) and 10% penicillin/streptomycin (Caisson, Smithfield, USA). The cell cultures were maintained within a controlled incubation environment (37°C, 5% CO2). To initiate adipocyte differentiation, the cells were seeded at a density of 4 × 105 cells per well in 6-well plates, at a point known as 2-day-post-confluent (day 0). These cells were subsequently exposed to a differentiation-inducing medium (DMI medium). The DMI medium composition included 0.5 mmol of 3-Isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich, St. Louis, USA), 0.1 µg/ml of Dexamethasone (DEX, Sigma-Aldrich, St. Louis, USA), and 5 µg/ml of insulin. This medium was prepared by adding the specified concentrations of components to DMEM supplemented with 10% fetal bovine serum (FBS, HyClone, Utah, USA). Upon reaching day 3, the DMI medium was replaced with INS medium, comprised of DMEM supplemented with 10% FBS and 5 µg/ml insulin. Additionally, kefir samples, diluted 100-fold, were introduced to the INS medium. As the experiment progressed to day 6, the INS medium was substituted with DMEM containing 10% FBS and kefir samples, and this medium was consistently maintained throughout the incubation period until day 9.
Cell viability assessment
To evaluate cell viability, 3T3-L1 pre-adipocytes were cultured in 96-well tissue culture plates at a density of 1 × 104 cells per well for a duration of 24 h. Upon achieving cellular confluency exceeding 80% within the culture wells, the cells were subjected to various treatments involving kefir samples. These treatments encompassed different dilutions: 200-fold, 100-fold, 50-fold, and undiluted (0-fold), each administered over a 48-h period. Concurrently, an untreated control group was maintained for comparison purposes. Upon completion of the kefir intervention, the culture medium was substituted with a solution of 0.5 mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, USA). The culture was allowed to continue incubating for an additional 4 h. Subsequently, the medium containing MTT was discarded, and 100 µl of dimethyl sulfoxide (DMSO, Labscan, Bangkok, Thailand) was introduced to extract the purple formazan crystals. The absorbance of the resultant solution was then measured at 540 nm using a microplate reader. The obtained results were calculated and subsequently presented as a percentage reflecting the cell viability.
Oil red O staining
The content of intracellular lipid accumulation was assessed through Oil Red O staining following the protocols of Kraus et al. (2016). Initially, the cells were washed with PBS and fixed with 10% formalin (Sigma-Aldrich) for 30 min at room temperature. After fixation, they were rinsed with distilled water, followed by treatment with 60% isopropanol (Labscan, Bangkok, Thailand) for 1-2 min each. Subsequently, the cells were stained with a working Oil Red O solution for 20 min at 60°C and an additional 20 min at room temperature. Following staining, the cells were washed with distilled water and examined under a microscope. For quantitative analysis of the staining content, Oil Red O was eluted with 100% isopropanol for 30 min. The dissolved Oil Red O content was then assessed using a microplate reader to measure the absorbance at 520 nm.
Glycerol-3-phosphate dehydrogenase (GPDH) enzyme activity assay
To examine the effect of selected kefir G3I1-10I on GPDH enzyme activity, post-differentiation, the enzyme activity was measured using the GPDH test kit (Sigma-Aldrich, St. Louis, USA). Briefly, the cells were washed twice with ice-cold PBS. Subsequently, GPDH assay buffer, consisting of 100 µl of 50 mmol/l Tris/Cl buffer (pH 7.5), 1 mmol/l ethylenediaminetetraacetic acid (EDTA), and 1 mmol/l β-mercaptoethanol, was added. After homogenization, the cell lysates were centrifuged at 10,000 g for 5 min at 4°C. The resulting supernatant was then combined with GPDH assay buffer, which contained 100 mmol/l triethanolamine/HCl buffer (pH 7.5), 2.5 mmol/l EDTA, 0.12 mmol/l NADH, and 0.2 mmol/l DHAP. Then GPDH activity was measured at 450 nm every 10 min until 60 min. The result was calculated, compared to NADH standard, and reported as percentages.
Real-time polymerase chain reaction (Real-time PCR)
Following full differentiation and treatment with the 100-fold dilution of G3I1-10I kefir, the cells were harvested, and total RNA was extracted using Trizol reagent (Macherey-Nagel, Düren, Germany). Subsequently, the RNA was synthesized into cDNA using the Tetro cDNA Synthesis Kit (Bioline, London, UK). Real-time PCR was performed using the Luna® Universal qPCR Master Mix (Bioline, London, UK), and specific primers for gene amplification relevant to adipocyte differentiation and lipogenesis were followed as described by Ho et al. (2013), including genes C/EBP-β, PPAR-γ, SREBP-1c, FAS, aP2, ACC, IL-6, and TNF-α. The initial denaturation of the PCR mixture was carried out at 95°C for 12 min, followed by 40 thermal cycles: 15 s at 95°C, 20 s at 57°C, and 20 s at 72°C. The quantity of each gene was determined and compared with that of the housekeeping gene, β-actin, serving as an internal control. This protocol was adapted from the methods of Ho et al. (2013), and Wu et al. (2017).
Immunofluorescence and confocal microscopy
After inducing differentiation and treating the cells with a 100-fold dilution of the G3I1-10I kefir, they were washed and fixed with 4% (w/v) formalin in PBS. Subsequently, the cells were blocked with 5% BSA in PBS for 1 h at room temperature. This was followed by an overnight incubation with the PPAR-γ rabbit pAb A1113 antibody (AB clonal, Woburn, MA, US) (1:500 dilution in 5% BSA) at 4°C followed by adding secondary antibodies conjugated with fluorescence dye (goat anti-rabbit antibody conjugated Alexa Fluor 647; 1: 1,000) whereas the Hoechst 33342 (Thermo scientific, Meridian RD, Rockford, USA) was used for nuclear staining at room temperature. Finally, the cells were observed under a confocal microscope (Nikon AX series, Tokyo, Japan) and analyzed with Nikon NIS-Element C program.
Statistical Analysis
All results were generated from independent triplicate experiments and are expressed as the mean ± SD. ANOVA and Tukey's tests were performed using the Statistical Package for the Social Sciences (SPSS, version 17; SPSS, Chicago, IL, USA). Statistically significant differences were considered at P < 0.05.
Grain weight and pH values of kefir grains and Indian gooseberry kefir
After the fermentation, weight of the grains in G1, G2, G3, and G4 increased from the initial inoculation at 2 ± 0.00 g (Figure 1). The grain weight of G3I2-20B was the highest at 3.14 ± 0.13 g while the grain weight of G1I2-10B was the lowest at 2.05 ± 0.05 g. The final pH value and the change in pH value during the fermentation (∆pH) in kefir liquor were measured and are presented in Table 1. Following fermentation, all kefir pH values decreased, with a range between 2.97 ± 0.01 and 3.16 ± 0.00 for 20B, 2.80 ± 0.02 and 2.94 ± 0.25 for 10B, 2.59 ± 0.01 and 2.96 ± 0.01 for 10I, and 2.81 ± 0.01 and 3.01 ± 0.02 for 10I10B. Notably, the pH values of the I1 group, when fermented with G1, G2, G3, and G4 using 10I sugar, exhibited a more pronounced decrease, falling below 2.59.

Effects of Indian gooseberry kefir on cell viability of 3T3-L1 pre-adipocytes
The cytotoxicity of kefir on 3T3-L1 preadipocytes was accessed using a cell viability assay. The MTT cell viability assay was performed to determine the viability of 3T3-L1 preadipocytes after 48-h of exposure to four different kefir concentrations (0, 50, 100, and 200-fold dilutions). The results are expressed as a percentage of cell viability relative to the untreated control. All tested kefir samples affected cell viability in a dose-dependent fashion (Figure 2). Treatment with kefir at the highest tested concentration (undiluted) resulted in a reduction of cell viability, but the extent varied among kefir samples. Among the grains, G1 showed the lowest cytotoxicity (Figure 2A) whereas the highest toxicity was observed in G4 (Figure 2D). Notably, at 100-fold dilution of kefir, no toxicity was observed, with cell viability exceeding 80% for both I1 and I2 Indian gooseberry kefir (Figure 2). Based on these findings, Indian gooseberry kefir at a 100-fold dilution was considered safe and suitable for use in all subsequent experiments.
Table 1. Final pH and pH changes (∆pH) in Indian gooseberry kefir after 48 h of fermentation. The data is expressed as the mean value ± the standard deviation (SD).
|
I1 |
|
|||||||||||||||||
|
Sugar |
G1 |
G2 |
G3 |
G4 |
|
|||||||||||||
|
pH final |
∆pH |
pH final |
∆pH |
pH final |
∆pH |
pH final |
∆pH |
|||||||||||
|
20B |
2.98 ± 0.01 |
0.11 ± 0.01 |
2.97 ± 0.01 |
0.12 ± 0.01 |
3.06 ± 0.01 |
0.07 ± 0.00 |
2.98 ± 0.01 |
0.04 ± 0.01 |
|
|||||||||
|
10B |
2.81 ± 0.01 |
0.04 ± 0.01 |
2.80 ± 0.02 |
0.10 ± 0.00 |
2.89 ± 0.01 |
0.05 ± 0.00 |
2.81 ± 0.01 |
0.04 ± 0.01 |
|
|||||||||
|
10I |
2.68 ± 0.01 |
0.05 ± 0.02 |
2.59 ± 0.01 |
0.11 ± 0.01 |
2.69 ± 0.02 |
0.02 ± 0.01 |
2.68 ± 0.01 |
0.05 ± 0.02 |
|
|||||||||
|
10I10B |
2.86 ± 0.00 |
0.06 ± 0.01 |
2.81 ± 0.01 |
0.10 ± 0.01 |
2.89 ± 0.01 |
0.05 ± 0.01 |
2.86 ± 0.00 |
0.06 ± 0.01 |
|
|||||||||
|
I2 |
|
|||||||||||||||||
|
Sugar |
G1 |
G2 |
G3 |
G4 |
|
|||||||||||||
|
pH final |
∆pH |
pH final |
∆pH |
pH final |
∆pH |
pH final |
∆pH |
|
||||||||||
|
20B |
3.16 ± 0.00 |
0.16 ± 0.00 |
3.06 ± 0.02 |
0.25 ± 0.01 |
3.13 ± 0.00 |
0.21 ± 0.01 |
3.09 ± 0.00 |
0.16 ± 0.01 |
|
|||||||||
|
10B |
2.97 ± 0.00 |
0.15 ± 0.00 |
2.91 ± 0.02 |
0.20 ± 0.01 |
2.97 ± 0.02 |
0.16 ± 0.03 |
2.89 ± 0.03 |
0.27 ± 0.04 |
|
|||||||||
|
10I |
2.76 ± 0.01 |
0.16 ± 0.00 |
2.70 ± 0.02 |
0.17 ± 0.01 |
2.74 ± 0.01 |
0.14 ± 0.01 |
2.74 ± 0.02 |
0.20 ± 0.02 |
|
|||||||||
|
10I10B |
3.01 ± 0.00 |
0.17 ± 0.01 |
2.91 ± 0.01 |
0.21 ± 0.02 |
2.98 ± 0.02 |
0.17 ± 0.02 |
2.96 ± 0.01 |
0.11 ± 0.02 |
|
|||||||||

Effect of Indian gooseberry kefir on intracellular lipid accumulation and GPDH enzyme activity in adipocytes
The effects of each Indian gooseberry kefir on lipid accumulation in 3T3-L1 mature adipocytes were determined using the Oil Red O staining method, serving as an indicator of the degree of lipid droplets in the cells. According to quantitative analysis results of the Oil Red O staining, treatment with kefir samples G3I1-10I, G4I2-10B, and G4I2-10I (at 100-fold dilution) decreased the amount of lipid droplets compared to the control (Figure 3). The highest efficiency was observed in G3I1-10I kefir treated cells which significantly lowered the percentage lipid accumulation to 88.86 ± 3.24% compared with untreated control (P < 0.05). Consistent with the Oil Red O staining, 3T3-L1 cells treated with G3I1-10I showed a remarkable reduction of intracellular oil droplets compared to untreated control cells, as shown in Figure 4. The reduction of lipid accumulation in the adipocytes after treatment with G3I1-10I kefir was related to the decrease in GPDH enzyme activity, which is an important cytosolic enzyme for converting glycerol to triglyceride. The treatment exhibited inhibitory activity, leading to a significant reduction in GPDH enzyme activity to 30.79 ± 3.4% relative to untreated control adipocytes (P < 0.05) (Figure 5).


Figure 4. Oil Red O staining of intracellular lipid accumulated in 3T3-L1 adipocytes after treatment with kefir G3I1-10I compared to untreated control, observed under a microscope at a magnification of ×100.

Figure 5. Effects of G3I1-10I kefir on GPDH enzyme activity in 3T3-L1 adipocytes. GPDH activity was significantly reduced (P < 0.05) after treatment compared to the untreated control.
Effect of G3I1-10I Indian gooseberry kefir on the mRNA expression levels of genes associated with adipocyte differentiation and lipogenesis
Adipogenesis is regulated by several transcriptional activators, including SREBP-1C, C/EBPβ, PPAR-γ, FAS, aP2, and ACC. As shown in Figure 6, the results demonstrate that a 100-fold dilution of G3I1-10I kefir significantly downregulated the expression levels of C/EBPβ, PPAR-γ, and ACC compared to the untreated control (P < 0.0255), (P < 0.0043), and (P < 0.003), respectively. Besides, the expression of FAS, a member of adipocyte-specific genes, was also decreased. We further investigated the effect of kefir on PPAR-γ expression and nuclear translocation in adipocytes using the immunofluorescence assay. The result indicated that the fluorescence intensity of PPAR-γ protein in G3I1-10I kefir treated-cells was obviously lower than that of non-treated cells, as shown in Figure 6, suggesting a reduction in the PPAR-γ protein level after treatment. Moreover, when compared to non-treated cells where PPAR-γ was concentrated in the nucleus, the pattern of PPAR-γ in kefir treated cells was slightly dispensed, possibly indicative of a disturbance in nuclear translocation (Figure 7). This study suggests that G3I1-10I kefir contributes to control the obesity by suppressing adipocyte differentiation through C/EBPβ, PPAR-γ, ACC, and FAS-related adipogenesis/lipogenesis.

Figure 6. Effect of G3I1-10I kefir on the mRNA expression levels of genes associated with adipocyte differentiation and lipogenesis. The expression values were calculated as normalized expression of differentiation genes relative to untreated cells (set as 1.0) where β-actin used as a housekeeping gene.

Figure 7. Effect of G3I1-10I kefir on PPAR-γ protein expression in 3T3-L1 adipocytes. The level of protein expression and nuclear translocation of PPAR-γ (red) were measured using immunofluorescence assay. The translocation of PPAR-γ was analyzed by confocal microscope where the nucleus was stained with Hoechst (blue). Scale bars correspond to 20 µm.
DISCUSSION
Obesity is a prevalent global health issue recognized as a metabolic disease (Jaradat et al., 2017). Numerous research studies investigate the impact of various treatments on 3T3-L1 adipocytes for their anti-differentiation and anti-adipogenesis properties. Water kefir is renowned for its health benefits attributed to major fermentation products such as lactic acid, acetic acid, ethanol, and other useful metabolites (Fiorda et al., 2017). Additionally, Indian gooseberry is identified as a source of minerals and phytochemicals with anti-obesity potential, including gallic acid, ellagic acid, and vitamin C (Park et al., 2020).
This study demonstrated that after fermentation, pH values of Indian gooseberry liquor in all groups decreased, while the weight of the grains increased (Table 1 and Figure 1). This suggests that during the fermentation process, microbes in the grain utilize brown sugar and inulin as carbon sources to synthesize exopolysaccharides, promoting grain growth. The results indicated that microbes can utilize inulin for their growth, with inulin selected as an alternative substrate due to its low-calorie content and potential health benefits for the digestive tract (Cufaoglu et al., 2023). A previous study established that Indian gooseberry kefir, when added with 20% (w/v) brown sugar, contributed to a 97.40% anti-lipogenesis effect on 3T3-L1 adipocytes without inducing toxicity. Unlike to sugar, which can induce insulin receptor and enhance lipogenesis through the insulin receptor pathway (Tamura et al., 2023), inulin is indicated as a probiotic substrate that does not induce the insulin receptor in cells (Campos-Perez et al., 2021). The current study, using Indian gooseberry kefir with 10% inulin, not only increased the grain amount but also showed a greater capacity to reduce intracellular lipid droplets compared to the brown sugar group, especially with G3I1-10I kefir (Figure 3 and 4). Moreover, comparing two Indian gooseberry species based on microbial growth effect, the result indicated that I1 had phytochemicals inhibiting lipogenesis to a greater extent than I2.
In vitro adipogenesis involves early and late stages regulated by different adipogenic genes. At the early stage, C/EBPβ expression is induced, followed by stimulation of PPAR-γ and C/EBPα via C/EBPβ, enhancing pre-adipocyte differentiation and promoting adipogenesis. At the later stage, FAS, ACC, and aP2 genes promote intracellular lipid in mature adipocytes (Merrett et al., 2020). Our finding showed that G3I1-10I kefir at a 100-fold dilution demonstrated a capacity to reduce lipid accumulation and GPDH enzyme activity during differentiation without inducing cytotoxicity (Figure 4 and 5). The results of GPDH enzyme activity and real-time PCR showed that G3I1-10I kefir had the most efficiency on anti-adipogenesis capacity in 3T3-L1 adipocytes, regulating specific enzymes and gene expressions related to C/EBPβ, PPAR-γ, and ACC (Figure 6). Our results were consistent with the previous studies which reported that kefir fractions reduced the expression of PPAR-γ (Ho et al., 2013). Moreover, obese mice treated with kefir exhibited decreased mRNA levels for lipogenesis genes (Chen et al., 2014). Other fermented foods with probiotics showed cooperative effects that suppressed PPAR-γ, C/EBPα, and FAS in 3T3-L1 adipocytes (Lee et al., 2019).
The translocation of mRNA from the nucleus to the cytoplasm is a key regulatory step influencing gene expression and metabolic processes. This process enables the translation of mRNA into a functional protein in the cytoplasm, where it may undergo post-transcriptional modifications. In this study, we demonstrated that the diminishment of PPAR-γ protein corresponds to the decrease in mRNA levels (Figure 7). Considering the crucial role of PPAR-γ transcription factor in adipogenesis and lipogenesis, the reduction of PPAR-γ mRNA expression is likely to affect the total PPAR-γ expression. This, in turn, may influence the magnitude of transcription in nucleus, potentially resulting in a diminished activation of genes associated with lipogenesis and adipocyte differentiation. This finely tuned regulation helps modulate PPAR-γ activity, preventing excessive lipid accumulation and adipogenesis. In the specific context of the study, the observed translocation of PPAR-γ mRNA in kefir-treated cells suggests a mechanism through which G3I1-10I kefir contributes to the reduction of lipogenesis in 3T3-L1 adipocytes.
CONCLUSION
In conclusion, Indian gooseberry kefir exhibits significant potential in inhibiting lipid accumulation in 3T3-L1 adipocytes. Particularly, G3I1-10I kefir effectively reduces fat accumulation by downregulating mRNA expressions of key adipogenic regulators, including C/EBPβ, PPAR-γ, and the adipocyte-specific gene ACC. The inclusion of 10% (w/v) inulin in G3I1-10I kefir enhances its impact by providing an alternative substrate that not only supports microbial growth during fermentation, contributing to increased grain formation but also serves as a low-calorie option with potential health benefits for the digestive tract. Moreover, the observed downregulation and nuclear translocation defect of the PPAR-γ protein induced by G3I1-10I kefir adds another layer of sophistication to its anti-adipogenic effects. This study underscores the combined benefits of Indian gooseberry and low-caloric water kefir, emphasizing their synergistic effect in significantly suppressing intracellular lipid accumulation in adipocytes. Pending further validation in animal experiments, the potential of kefir, further amplified by the benefits of inulin and its low-caloric nature, suggests its role as a functional health food for weight management and overall health promotion.
ACKNOWLEDGEMENTS
We sincerely thank the National Research Council of Thailand (NRCT) for their generous support (Grant No. N23A640051) and the Graduate School of Chiang Mai University for providing Teaching and Research Assistant scholarships through the PhD program. We also appreciate the partial support from the Office of Research Administration and the Research Group of Natural Extracts and Innovative Products for Alternative Healthcare at Chiang Mai University. Their contributions were crucial to the success of this research.
AUTHOR CONTRIBUTIONS
Natsinee U-on: Data Curation (Lead), Formal Analysis (Lead), Investigation (Lead), Methodology (Lead), Software (Lead), Conceptualization (Supporting), Writing – Original Draft (Lead); Itthayakorn Promputtha: Conceptualization (Lead), Supervision (Lead), Funding Acquisition (Lead), Project Administration (Lead), Resources (Lead), Validation (Lead), Visualization (Equal), Writing – Review & Editing (Lead), Formal Analysis (Supporting); Yingmanee Tragoolpua: Conceptualization (Supporting), Supervision (Supporting); Aussara Panya: Conceptualization (Supporting), Supervision (Equal), Formal Analysis (Equal), Visualization (Supporting), Writing – Review & Editing (Supporting); Arisa Imsumran: Conceptualization (Supporting), Supervision (Supporting).
CONFLICT OF INTEREST
The authors declare that they hold no competing interests.
REFERENCES
Alsayadi, M., Jawfi, Y.A., Belarbi, M., Soualem-Mami, Z., Merzouk, H., Sari, D.C., Sabri, F., and Ghalim M. 2014. Evaluation of anti-hyperglycemic and anti-hyperlipidemic activities of water kefir as probiotic on streptozotocin-induced diabetic wistar rats. Journal of Diabetes Mellitus. 4(2): 85–95. http://dx.doi.org/10.4236/jdm.2014.42015
Campos-Perez, W. and Martinez-Lopez, E. 2021. Effects of short chain fatty acids on metabolic and inflammatory processes in human health. Molecular and Cell Biology of Lipids. 1866(5): 158900. https://doi.org/10.1016/j.bbalip.2021.158900
Chen, H.L., Tung, Y.T., Tsai, C.L., Lai, C.W., Lai, Z.L., Tsai, H.C., Lin, Y.L., Wang, C.H., and Chen, C.M. 2014. Kefir improves fatty liver syndrome by inhibiting the lipogenesis pathway in leptin-deficient Ob/Ob knockout mice. International Journal of Obesity. 38: 1172–1179. https://doi.org/10.1038/ijo.2013.236
Chooi, Y.C., Ding, C., and Magkos, F. 2019. The epidemiology of obesity. Metabolism. 92: 6–10. https://doi.org/10.1016/j.metabol.2018.09.005
Cufaoglu, G. and Erdinc, A.N. 2023. An alternative source of probiotics: Water kefir. Food Frontiers. 4: 21–31. https://doi.org/10.1002/fft2.200
Fiorda, F.A., de Melo Pereira, G.V., Thomaz-Soccol, V., Rakshit, S.K., Pagnoncelli, M.G.B., Vandenberghe, L.P. de S., and Soccol, C.R. 2017. Microbiological, biochemical, and functional aspects of sugary kefir fermentation: A review. Food Microbiology. 66: 86–95. https://doi.org/10.1016/j.fm.2017.04.004
Gandhi, D., Venugopal, S., Mehta, M., and Agnihotri, S. 2025. A review on Amla (Emblica officinalis): The traditional Indian superfood. International Journal for Multidisciplinary Research. 7(2): 1–7. http://doi.org/10.36948/ijfmr.2025.v07i02.40323
Ho, J.N., Choi, J.W., Lim, W.C., Kim, M.K., Lee, I.Y., and Cho, H.Y. 2013. Kefir inhibits 3T3-L1 adipocyte differentiation through down-regulation of adipogenic transcription factor expression. Journal of the Science of Food and Agriculture. 93: 485–490. https://doi.org/10.1002/jsfa.5792
Jaradat, N., Zaid, A.N., and Zaghal, E.Z. 2017. Anti-lipase activity for Portulaca oleracea, Urtica urens, Brassica napus and Lathyrus hierosolymitanus wild plants from Palestine. Marmara Pharmaceutical Journal. 21: 828–836. https://doi.org/10.12991/mpj.2017.9
Kabade, V.S. 2022. Emblica officinalis (Amla): A review of therapeutic applications. International Journal of Creative Research Thoughts. 10(11): e743-750.
Klawpiyapamornkun, T., Kaewkod, T., Uttarotai, T., Wangkarn, S., Sirisa-ard, P., Kiatkarun, S., Tragoolpua, Y., and Bovonsombut S. 2023. Efficacy of dried Indian gooseberry kombucha on a pre–industrial scale: Chemical composition, antioxidant and antibacterial activity. Chiang Mai Journal of Science. 50(3): e2023034. https://doi.org/10.12982/CMJS.2023.034
Kraus, N.A., Ehebauer, F., Zapp, B., Rudolphi, B., Kraus, B.J., and Kraus, D. 2016. Quantitative assessment of adipocyte differentiation in cell culture. Adipocyte. 5: 351–358. https://doi.org/10.1080/21623945.2016.1240137
Lee, M., Kim, J., Choi, J., Park, J., Kim, H., Song, B., Choi, Y., Kim, K., Song, H., and Hwang, D. 2019. Anti-obesity effect in high fat diet induced obese C57BL/6 mice: Study of a novel extract from mulberry (Morus alba) leaves fermented with Cordyceps militaris. Experimental and Therapeutic Medicine. 17(3): 2185–2193. https://doi.org/10.3892/etm.2019.7191
Merrett, J.E., Bo, T., Psaltis, P.J., and Proud, C.G. 2020. Identification of DNA response elements regulating expression of CCAAT/enhancer-binding protein (C/EBP) β and δ and MAP kinase-interacting kinases during early adipogenesis. Adipocyte. 9: 427–442. https://doi.org/10.1080/21623945.2020.1796361
Moghadam, B.E., Keivaninahr, F., Fouladi, M., Reza, R.M., and Nazemi A. 2019. Inulin addition to yoghurt: Prebiotic activity, health effects and sensory properties. International Journal of Dairy Technology. 72: 183–198. https://doi.org/10.1002/fft2.92
Monajjemi, M., Aminin, A.L.N., Ilkhani, A.R., and Mollaamin F. 2012. Nano study of antioxidant activities of fermented soy whey prepared with lactic acid bacteria and kefir. African Journal of Microbiology Research. 6: 426–430. https://doi.org/10.5897/ajmr11.1249.
Park, S.J., Kim, J.L., Park, M.R., Lee, J.W., Kim, O.K., and Lee, J. 2022. Indian gooseberry and barley sprout mixture prevents obesity by regulating adipogenesis, lipogenesis, and lipolysis in C57BL/6J mice with high-fat diet-induced obesity. Journal of Functional Foods. 90: 104951. https://doi.org/10.1016/j.jff.2022.104951
Park, S.J., Kim, D., Kim, J.L., Park, M.R., Kim, T.G., Kim, O.K., and Nam, D.E. 2020. Indian gooseberry and barley sprout mixture inhibits adipogenesis and lipogenesis activity in 3T3-L1 adipocytes. Applied Sciences. 10: 21–31. https://doi.org/10.3390/app10249078
Sabokbar, N. and Khodaiyan F. 2015. Characterization of pomegranate juice and whey based novel beverage fermented by kefir grains. Journal of Food Science and Technology. 52(6): 3711–3718. https://doi.org/10.1007/s13197-014-1412-9
Sharma, N., Palia, P., Chaudhary, A., and Shivali. 2020. A review on Indian Gooseberry Emblica officinalis (Amla) and its medicinal potential. International Journal of Research and Analytical Reviews. 7(3): 717-730.
Tamura, I., Shiroshita, A., Fujimura, T., Tanaka-Doi, Y., Shirafuta, Y., Taketani, T., Sato, S., and Sugino, N. 2023. Glucose and lipid metabolisms in human endometrial stromal cells during decidualization. Endocrine Journal. 70: 465–472. https://doi.org/10.1507/endocrj.EJ23-0099
Teferra, T.F. 2021. Possible actions of inulin as prebiotic polysaccharide: A review. Food Frontiers. 2: 393–575. https://doi.org/10.1002/fft2.92.
Wu, M., Liu, D., Zeng, R., Xian, T., Lu, Y., Zeng, G., Sun, Z., Huang, B., and Huang Q. 2017. Epigallocatechin-3-gallate inhibits adipogenesis through down-regulation of PPARγ and FAS expression mediated by PI3K-AKT signaling in 3T3-L1 cells. European Journal of Pharmacology. 795: 134–142. https://doi.org/10.1016/j.ejphar.2016.12.006
OPEN access freely available online
Natural and Life Sciences Communications
Chiang Mai University, Thailand. https://cmuj.cmu.ac.th
Supplementary
Table S1. List of primers used in this study.
|
Name |
Forward Sequences (5’-3’) |
Reverse Sequences (5’-3’) |
|
C/EBPβ |
GGGGTTGTTGATGTTTTTGG |
CGAAACGGAAAAGGTTCTCA |
|
PPARγ |
CGCTGATGCACTGCCTATGA |
AGAGGTCCACAGAGCTGATTCC |
|
SREBP-1c |
GGCACTAAGTGCCCTCAACCT |
GCCACATAGATCTCTGCCAGTGT |
|
FAS |
CCTGGATAGCATTCCGAACCT |
AGCACATCTCGAAGGCTACACA |
|
aP2 |
CATGGCCAAGCCCAACAT |
CGCCCAGTTTGAAGGAAATC |
|
ACC |
AGTCCTGATTGAGCATGGCA |
CTCCAGATGGCGGTAGATTC |
|
IL-6 |
AGTTGCCTTCTTGGGACTGA |
CAGAATTGCCATTGCACAAC |
|
TNF-α |
ACGGCATGGATCTCAAAGAC |
GTGGGTGAGGAGCAGTAGT |
|
β-Actin |
TGTCCACCTTCCAGCAGATGT |
AGCTCAGTAACAGTCCGCCTAGA |
Natsinee U-on1, Yingmanee Tragoolpua1, 2, Aussara Panya1, 2, Arisa Imsumran3, and Itthayakorn Promputtha1 ,2, *
1 Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200, Thailand.
2 Natural Extracts and Innovative Products for Alternative Healthcare Research Group, Chiang Mai University, Chiang Mai 50200, Thailand.
3 Department of Biochemistry, Faculty of Medicine, Chiang Mai University, Chiang Mai 50200, Thailand.
Corresponding author: Itthayakorn Promputtha, E-mail: itthayakorn.p@cmu.ac.th
ORCID iD:
Natsinee U-on: https://orcid.org/0009-0001-5560-4309
Itthayakorn Promputtha: https://orcid.org/0000-0003-3376-4376
Total Article Views
Editor: Sirasit Srinuanpan,
Chiang Mai University, Thailand
Article history:
Received: January 11, 2025;
Revised: March 8, 2026;
Accepted: March 20, 2026;
Online First: April 22, 2026